 |
 |
 |
| 1. |
Which of the following statements is true?
[Hint]
|
 |
 |
 |
| 2. |
Where are the DNA polymerase enzymes synthesized in a eukaryotic cell?
[Hint]
|
 |
 |
 |
| 3. |
Examine the following DNA sequence. Which of the strands below represents the complementary RNA strand that would be formed from this DNA strand? 5 AATTGCGCTTAG 3
[Hint]
|
 |
 |
 |
| 4. |
If there were a mutation in the promoter region of the DNA used in this experiment that prevented RNA polymerase from recognizing it, which of the following describes the most likely result? Assume that the photo in part B is of the filter used in the experiment described.
[Hint]
|
 |
 |
 |
| 5. |
Transcription normally stops when
[Hint]
|
 |
 |
 |
| 6. |
Which of the following statements is true regarding transcription in bacteria and eukaryotes?
[Hint]
|
 |
 |
 |
| 7. |
Researchers have found that as they add more molecules of RNA polymerase to a solution of 10 mL of viral DNA, the two molecules bind tightly to each other up until a point where there are 18 molecules of RNA polymerase per molecule of DNA. At this point, there is a significant amount of RNA polymerase that is left unbound in the solution. These results suggest that
[Hint]
|
 |
 |
 |
| 8. |
This figure represents the results of an experiment where purified mRNA coded for by this DNA was incubated with the DNA molecule under conditions that favored complementary base pairing.
The results in the figure suggest that
[Hint]
|
 |
 |
 |
| 9. |
Which of the following is an advantage (relative to bacteria) of the way transcription occurs in eukaryotes?
[Hint]
|
 |
 |
 |
| 10. |
In this experiment, cells were treated with radioactive amino acids for a very short time. The results show the location of these amino acids immediately following the treatment (a), and 2 minutes later (b). Where would you most likely find the radioactive amino acids after more time (1 hour) has passed?
[Hint]
|
 |
 |
 |
| 11. |
What is the maximum number of amino acids that could be produced from the following mRNA sequence? 5 AAUCCGUAAAUGAGACCGUCGAUGAAUUAGCG 3
[Hint]
|
 |
 |
 |
| 12. |
Which of the following best describes the effect of a mutation in the Trp aminoacyl tRNA synthetase that changed the conformation of the tRNA binding site?
[Hint]
|
 |
 |
 |
| 13. |
Which of the following are required as an energy source for translation?
[Hint]
|
 |
 |
 |
| 14. |
What is the best description of the loops in the tRNA molecule?
[Hint]
|
 |
 |
 |
| 15. |
The tRNA shown in the figure represents the characteristic L shape of this molecule. Which of the following would be the most likely result if a number of hydrogen bonds in the region labeled hydrogen bonds in the figure were broken using some type of chemical treatment?
[Hint]
|
 |
 |
 |
| 16. |
Which of the following mRNA sequences could be bound to the tRNA anticodon? 3 GGC 5
[Hint]
|
 |
 |
 |
| 17. |
Refer to the figure shown. Which of the following statements is NOT true regarding translation in bacteria?
[Hint]
|
 |
 |
 |
| 18. |
If there were a mutation in a ribosome that prevented tRNA molecules from moving into the E site, how many amino acids would be found in the resulting peptide chain formed on this ribosome?
[Hint]
|
 |
 |
 |
| 19. |
Which of the following statements is correct regarding the figure shown?
[Hint]
|
 |
 |
 |
| 20. |
Some proteins can act as infectious proteins, or prions. These proteins have an abnormal conformation, and cause other normal proteins to change to the mutant form, resulting in a number of disorders, including mad cow disease. This process is similar to which of the following normal processes in the cell?
[Hint]
|
 |
 |
 |
|
Answer choices in this exercise are randomized and will appear in a different order each time the page is loaded.
|
| |
|
|